anonymous 16352 qPCR before and after bleaching and after symbiont switing in the foraminifera Sorites orbiculus Timme, Lukas Theodor; Henschen, Helena; Puerto Rueda, Diana N; Manda, Sneha; Parkinson, John Everett; Wild, Christian; Abramovich, Sigal; Morard, Raphael; Schmidt, Christiane (2026): qPCR before and after bleaching and after symbiont switing in the foraminifera Sorites orbiculus [dataset]. PANGAEA, https://doi.org/10.1594/PANGAEA.984044, In: Timme, LT et al. (2026): Menthol-DCMU bleaching and re-inoculation of Symbiodiniaceae in the large benthic foraminifera Sorites orbiculus [dataset bundled publication]. PANGAEA, https://doi.org/10.1594/PANGAEA.984033 The uptake of novel Symbiodiniaceae strains in Sorites orbiculus was measured using qPCR. To facilitate novel algae uptake, the specimens were bleached for 27 days with 0.19 mmol L-1 menthol and 5 µmol L-1 DCMU, followed by 19 days of re-inoculation with the Symbiodinium microadriaticum (strains KB8 and CCMP2467) and Fugacium kawagutii (strain F2) individually and collectively at a concentration of 1e5 cells ml-1 and a further observation for 37 days to verify long-term establishment of symbiosis. The primer pairs S.S.ITS2F (5′- TTCTGCTGCTCTTGTTATCAGG− 3′) and S.S.ITS2R (5′- ACACACATGAGCTTTTGTTTCG− 3′) were used and qPCR measurements were performed before the start of the experiment, after the bleaching experiment and after the symbiosis stability evaluation. 16360 https://doi.org/10.1594/PANGAEA.984044 2026-02-02T11:41:21+0000 2026 21965 21968 21971 21972 21973 21974 21509 21975 21976 14124 21977 21978 21508 21979